Translation

Friday March 22^nd

The following DNA strand contains a promoter region and then a specific gene that is to be transcribed (go through transcription)  I highlighted the side of dna that will go through transcription

AGCTATAAGCATCCGGATTACGC
TCGATATTCGTAGGCCTAATGCG

What area of this DNA Strand is part of the promoter region?

  TATAA (the TATA Box)  This signals that start of a gene to be transcribed.

What would the resulting mRNA sequence be?

 GUAGGCCUAAU

(Remember A codes for U in RNA, not T)

What happens to the DNA molecule once it is read?  It gets zipped right back up again.

Friday we then went through the steps of translation using some more models.  See the notes and pics below.

The mRNA (White strip) the Ribosome (Red) and the tRNA (blue)
all form together. The first amino acid of ALL proteins is
methionine code for by the mRNA code Methionine

the second tRNA carrying the next amino acid joins

A Peptide bon forms between the two amino acids and the first tRNA is released where it can pick up more
amino acids 

tRNA's continue to bring in amino acids until a STOP codon is reached.

Once the stop codon is reached the amino acid chain (AKA a protein)
is released.

Here is a review by "Mr.Anderson" on these two topics!

Other good source is from the Khan Academy 

Monday and Tuesday of this week we took our CDT's.  Most of you are scoring close to where I would like you to be.  We have another tough 6 weeks before the keystone exam but I am feeling confident that you guys will do great!
Hope you have a nice Easter break!