Wednesday, April 3, 2013

Wrap up translation - into mutations


Tuesday April 2nd we didn't have a daily question per se... instead we did a wrap up activity on transcription and translation with the following problems.
If you look at the Red line on problem 1 - I changed one nucleotide, which in turn, changed one of the amino acids this is an example of a missense mutation.
In the second one, I also changed ONE nucleotide, but this time it would have NO affect on the protein because it still coded for the same amino acid.  This is an example of a silent mutation.
Imagine though that I inserted a nucleotide or deleated one......  THIS is what would happen to the reading frame during tranlsation.
We then wrapped up the translation notes that you needed to finish.
Wednesday April 3rd
A frameshift mutation early in a gene is most likely to have which effect on the protein for which the mutated gene codes?
1.  The protein will be silent
2.  the protein will have extensive incorrect amino acid sequences
3.  the protein will perform its function better than a nonmutated copy
4.  the protein will function normally because any changes will be minor

The genetic code is classified as redundant because more than one codon codes for most amino acids.  This feature of the genetic code makes which type of mutation possible?
1.  Silent      2.  Nonsense 
3. frameshift 4.  catastrophic
These two DQ's acted as an introduction to today's notes. While I had you actually go through these types of mutations yesterday, we had not yet written down the notes.  I also wanted to make sure that you understood the OVERALL processes of transcription and translation so we worked through the following diagram
This required one extra slide of notes to help you out.
We then went through the following notes on mutations:




Tuesday, March 26, 2013

Translation


Friday March 22nd
The following DNA strand contains a promoter region and then a specific gene that is to be transcribed (go through transcription)  I highlighted the side of dna that will go through transcription

AGCTATAAGCATCCGGATTACGC
TCGATATTCGTAGGCCTAATGCG

What area of this DNA Strand is part of the promoter region?
  TATAA (the TATA Box)  This signals that start of a gene to be transcribed.

What would the resulting mRNA sequence be?
 GUAGGCCUAAU
(Remember A codes for U in RNA, not T)
What happens to the DNA molecule once it is read?  It gets zipped right back up again.

Friday we then went through the steps of translation using some more models.  See the notes and pics below.
The mRNA (White strip) the Ribosome (Red) and the tRNA (blue)
all form together. The first amino acid of ALL proteins is
methionine code for by the mRNA code Methionine
the second tRNA carrying the next amino acid joins
A Peptide bon forms between the two amino acids and the first tRNA is released where it can pick up more
amino acids 
tRNA's continue to bring in amino acids until a STOP codon is reached.
Once the stop codon is reached the amino acid chain (AKA a protein)
is released.
Here is a review by "Mr.Anderson" on these two topics!
Other good source is from the Khan Academy 

Monday and Tuesday of this week we took our CDT's.  Most of you are scoring close to where I would like you to be.  We have another tough 6 weeks before the keystone exam but I am feeling confident that you guys will do great!
Hope you have a nice Easter break!

Thursday, March 21, 2013

Transcription


Thursday March 21st 
DNA ultimately codes for what macromolecule?
 Proteins
What subunits make up that macromolecule?
 Amino Acids
Where does the synthesis of that molecule occur?
 Ribosomes
DNA does not directly make protein, what molecule is the “messenger” for the “boss”?
RNA (specifically mRNA)
Today we got into our discussion on transcription.  This involved working with the Kinex models again. (See pics below)
DNA on the Right, RNA on the Left
The DNA splits open once a promotor region is reached and RNA Polymerase adds nucleotides according to base pairing rules.
Notice thought that thymines (black) are not added to the adenine (white) instead it is replaced by uracil.
As the RNA molecule is made is separates and the the DNA molecule zips back up together.






We then watched the first half of the following video that shows this in real time in our cells

Transcription Translation Introduction

Monday we did an activity on blood typing.  This was just to wrap up heredity and put it into some "real" terms.







Tuesday I was at Carnegie Mellon performing a lab on gene expression which is exactly the next chapter we are getting into!  While I was there, you wrote down a bulk of the notes for this chapter so we can spend more time on discussion and activities.
Wednesday, I introduced the topic and let you watch the following two videos as  a preview.

Tuesday, February 26, 2013

Nondisjunction

Tuesday February 26th
At the end of meiosis we have created 4 haploid gametes, in males these are known as Sperm in females these are known as Eggs

If a female gamete and a male gamete combined, how many chromosomes would the resulting cell have? 46 which would be haploid or diploid?

During meiosis 1 homologous chromosomes separate from each other.  If this did not happen with one of the pairs and then meiosis went on as normal what would the resulting gametes look like?
The result would be two of the gametes having an extra chromosome and the other two gametes missing a chromosome.  
After going through the daily questions and using your magnetic chromosomes, we moved into notes on this specific abnormality known as nondisjunction - For an online tutorial on this check out the following link http://learn.genetics.utah.edu/content/begin/traits/predictdisorder/