Translation

Friday March 22^nd

The following DNA strand contains a promoter region and then a specific gene that is to be transcribed (go through transcription)  I highlighted the side of dna that will go through transcription

AGCTATAAGCATCCGGATTACGC
TCGATATTCGTAGGCCTAATGCG

What area of this DNA Strand is part of the promoter region?

  TATAA (the TATA Box)  This signals that start of a gene to be transcribed.

What would the resulting mRNA sequence be?

 GUAGGCCUAAU

(Remember A codes for U in RNA, not T)

What happens to the DNA molecule once it is read?  It gets zipped right back up again.

Friday we then went through the steps of translation using some more models.  See the notes and pics below.

The mRNA (White strip) the Ribosome (Red) and the tRNA (blue)
all form together. The first amino acid of ALL proteins is
methionine code for by the mRNA code Methionine

the second tRNA carrying the next amino acid joins

A Peptide bon forms between the two amino acids and the first tRNA is released where it can pick up more
amino acids 

tRNA's continue to bring in amino acids until a STOP codon is reached.

Once the stop codon is reached the amino acid chain (AKA a protein)
is released.

Here is a review by "Mr.Anderson" on these two topics!

Other good source is from the Khan Academy 

Monday and Tuesday of this week we took our CDT's.  Most of you are scoring close to where I would like you to be.  We have another tough 6 weeks before the keystone exam but I am feeling confident that you guys will do great!
Hope you have a nice Easter break!

Transcription

Thursday March 21^st 

DNA ultimately codes for what macromolecule?

 Proteins

What subunits make up that macromolecule?

 Amino Acids

Where does the synthesis of that molecule occur?

 Ribosomes

DNA does not directly make protein, what molecule is the “messenger” for the “boss”?

RNA (specifically mRNA)

Today we got into our discussion on transcription.  This involved working with the Kinex models again. (See pics below)

DNA on the Right, RNA on the Left

The DNA splits open once a promotor region is reached and RNA Polymerase adds nucleotides according to base pairing rules.

Notice thought that thymines (black) are not added to the adenine (white) instead it is replaced by uracil.

As the RNA molecule is made is separates and the the DNA molecule zips back up together.

We then watched the first half of the following video that shows this in real time in our cells

Transcription Translation Introduction

Monday we did an activity on blood typing.  This was just to wrap up heredity and put it into some "real" terms.

Tuesday I was at Carnegie Mellon performing a lab on gene expression which is exactly the next chapter we are getting into!  While I was there, you wrote down a bulk of the notes for this chapter so we can spend more time on discussion and activities.
Wednesday, I introduced the topic and let you watch the following two videos as  a preview.